آشنایی با تکنیک مولکولی qMSP-PCR

آشنایی با تکنیک مولکولی qMSP-PCR

آشنایی با تکنیک مولکولی qMSP-PCR

سودا ذبیحی خداپسند (کارشناس زیست‌شناسی سلولی و مولکولی- بیوتکنولوژی)

مهسا جمالی (کارشناس ارشد ژنتیک)

qMSP-PCR

 نگارنده مسئول: سودا ذبیحی خداپسند

 

qMSP-PCR می‌تواند در تشخیص و ارزیابی خطر برای سرطان برحسب متیلاسیون DNA مفید باشد. متیلاسیون DNA مکانیسمی است که سلول‌ها به‌وسیله‌ی آن بیان ژن را کنترل می‌کنند و ژن‌های خاص سلولی اغلب الگوهای منحصربه‌فرد متیلاسیون را نشان می‌دهند. متیلاسیون DNA ژن‌های سرکوب‌کننده تومور در اوایل پیشرفت تومور رخ می‌دهد.

qMSP-PCR

(Quantitative Methylation Specific PCR) qMSP-PCR یک مشتق از MSP معمولی است با حساسیت ۱۰ برابری و استفاده از یک پروب با برچسب فلوروسنت به‌منظور اندازه‌گیری متیلاسیون DNA (سنجش وضعیت متیلاسیون جزایر CPG) که شامل اصلاح شیمیایی DNA ژنومی با استفاده از بی‌سولفیت سدیم می‌باشد؛ بدین صورت که سیتوزین‌های غیرمتیله به اوراسیل تبدیل می‌گردند ولی متیله به‌صورت ۵-متیل سیتوزین مقاوم به این اصلاح به‌عنوان سیتوزین باقی می‌ماند و می‌تواند با استفاده از روش اسپکتروفوتومتر (UV) اندازه‌گیری شود و تا زمان استفاده در دمای۲۰ – درجه سانتیگراد ذخیره گردد. سطح متیلاسیون به‌عنوان نسبت اندازه‌گیری‌های حاصل از ژن‌های هدف و ژن‌های مرجع تعریف شده است و اجازه‌ی اندازه‌گیری و مقایسه پروسه‌های مختلف  PCRرا می‌دهد. تست‌هایqMSP به‌منظور تکثیر توالی‌های هدف DNA متیله‌شده با بی‌سولفیت در حضور توالی‌های غیرمتیله مورد استفاده قرار می‌گیرد. این تست بر پایه Real time PCR و شامل توالی‌های پرایمر وابسته به متیلاسیون و پروب فلئوروژنیک برای مشخص کردن DNA اصلاح‌شده با بی‌سولفیت سدیم می‌باشد. استفاده از پروب‌هایی که دارای یک اتصال‌دهنده کوچک می‌باشند (به‌عنوان مثال Taq man) باعث توانایی استفاده از پروب‌های کوتاه و به تبع آن تسهیل طراحی و افزایش قابل‌توجهی در ویژگی خاص تحلیلی واکنش می‌گردد، علاوه بر این یک اولیگونوکلئوتید مرکزی مشخص‌شده توسط دو فلئوروکروم اعمال می‌شود که شامل Taq man و همچنین پرایمرهای مکمل دنباله پروموتور است که از جزایر CPG متیله پس از تبدیل بی‌سولفیت توسعه می‌یابد.

واکنش‌های شامل nm 250 پروب nm300-900 پرایمرها (غلظت پرایمر تعیین‌کننده مهم حساسیت و خصوصیات تحلیلی است و باید به‌صورت تجربی آزمایش شود) و ml2 از DNA بی‌سولفیته که در دستگاه Real time PCR 7500 Fast تحت چرخه‌ی حرارتی ° ۹۵ سانتیگراد به مدت ۱۰ دقیقه (مرحله‌ی فعال‌سازی) و پنجاه چرخه‌ی °c95 برای ۱۵ ثانیه (شامل دناتوراسیون) و °۵۸ الی°۶۵ سانتیگراد برای یک دقیقه (مرحله‌ی آنلینگ و گسترش که بسته به شرایط بازه دمایی تغییر می‌کند) جهت تشخیص اختصاصی فعالیت ‘۵ نوکلئازی به کار می‌رود.

Primer/probe mix Final concentration (nM)
Fwd primer Rev Primer   Probe
p16 ۷۰۰ ۷۰۰ ۲۵۰
TERT ۲۵۰ ۲۵۰ ۲۵۰
RASSF1 ۷۰۰ ۷۰۰ ۲۵۰
TMEFF2 ۹۰۰ ۹۰۰ ۲۵۰
CYGB ۳۰۰ ۳۰۰ ۲۵۰
RARb ۵۰۰ ۵۰۰ ۲۵۰
DAPK1 ۲۵۰ ۲۵۰ ۲۵۰
p73 ۲۵۰ ۲۵۰ ۲۵۰
WT1 ۷۵۰ ۷۵۰ ۲۵۰
CDH13 ۲۵۰ ۲۵۰ ۲۵۰
ACTB ۹۰۰ ۹۰۰ ۲۵۰

 

Genes Annealing temp (°C)  Time (sec)
p16 ۶۰ ۶۰
RASSF1 ۶۰ ۶۰
CYGB ۶۴ ۵
۶۱ ۵۵
RARB ۶۵ ۵
۶۲ ۵۵
TERT ۶۵ ۵
۶۲٫۵ ۵۵
WT ۶۲ ۶۰
ACTB ۵۸ ۲۰
۶۰ ۴۰
CDH13 ۶۴ ۵
۶۱ ۵۵
DAPK ۶۵ ۵
۶۲٫۵ ۵۵
P73 ۶۵ ۵
۶۲٫۵ ۵۵
TMEFF ۵۸ ۲۰

 

برای سنجش ‘۵ نوکلئاز یک اولیگو نوکلئوتید کهTaq man®probe  نامیده می‌شود به ترتیب واکنشگر PCR افزوده می‌شود. زمانی که آنزیم به شناساگر گرم‌‌شده می‌رسد، فعالیت ‘۵ نوکلئازی آنزیم موجب شکافته شدن شناساگر می‌شود. توالی Taq man®probe در انتهای ‘۵ خود رنگدانه‌ای با انرژی بالا دارد که ریپورتر (گزارشگر) نامیده می‌شود و در انتهای ‘۳ خود یک مولکول با انرژی پایین به نام کوئنچر (خاموش‌کننده) دارد. زمانی که این شناساگر دست نخورده است و به‌وسیله‌ی منبع نور القا می‌شود رنگ‌دانهq  مانع نشر رنگ‌دانه R  می‌شود. در نتیجه این عمل رنگ‌دانه‌ها به هم نزدیک می‌شوند. هنگامی که شناساگر به‌وسیله فعالیت ‘۵ نوکلئازی آنزیم شکافته می‌شود فاصله بین R  وq  افزایش می‌یابد و این امر موجب توقف انتقال انرژی می‌شود. القای فلئوروسنتR  افزایش می‌یابد درحالی‌کهq  کاهش پیدا می‌کند. افزایش سیگنال R برحسب زمان و متناسب با مقدار تولید برای یک نمونه معین در طی مرحله‌ی انحلال برای تعیین قطر چرخه (CT) جمع‌آوری شده و سپس داده‌های منحنی آمپلی‌فیکاسیون و ملتینگ با استفاده از نرم‌افزار stratagene Mxpro qPCR مورد تجزیه‌وتحلیل قرار می‌گیرد.

 

پروتکل تبدیل بی‌سولفات

در زمان شروع تبدیل بی‌سولفیت، به‌منظور اطمینان از عملکرد مطلوب و دقت پس از تجزیه‌وتحلیل متیلاسیون DNA، بهتر است ملاحظاتی را در ذهنمان بسپاریم. تریت کردن با بی‌سولفیت ذاتاً فرایندی سخت است که منجر به تغییر خواص فیزیکی و شیمیایی DNA می‌گردد. DNAهای ورودی از یک مولکول دورشته‌ای پایدار و بزرگ به کلکسیونی از قطعات تک‌رشته‌ای که همگی سیتوزین‌های تبدیل‌شونده به یوراسیل را دارند، تبدیل می‌شوند. این تغییرات به‌طور چشمگیری روی کمیت، ارزیابی کیفیت، تکثیر و آنالیز بی‌سولفیت DNA تأثیر می‌گذارد.

qMSP-PCR

qMSP-PCR

بی‌سولفیت PCR و طراحی پرایمر:

این تکنیک جزء شایع‌ترین تکنیک‌های مورد استفاده برای تجزیه‌وتحلیل متیلاسیون DNAی تغییر یافته با بی‌سولفیت بوده و نسبت به حوادث ناگوار خیلی مستعد می‌باشد. به خاطر داشته باشید که DNA به‌طور قابل‌توجهی قطعه می‌شود و به‌صورت رشته‌های کوتاه درمی‌آید و تقریباً به‌طور کامل عاری از سیتوزین می‌شود. برخلاف PCR معمولی، پرایمرهای بی‌سولفیت PCR نیاز دارند که مقداری طویل‌تر در حدود ۲۶ تا ۳۰ باز باشند و اندازه قطعه هدف باید نسبتاً کوتاه‌تر در حدود ۱۵۰تا ۳۰۰ جفت باز باشد. به‌طور ایده‌آل، پرایمرها نباید محتوی CPG باشند، بااین‌حال، وجود CPG در انتهای `۵ پرایمر با بازهای آمیخته در موقعیت سیتوزینی ضروری می‌باشد. همچنین توجه به این نکته اهمیت دارد که فقط یک رشته الگوی تغییریافته توسط بی‌سولفیتی توسط پرایمر آمپلی‌فای خواهد شد. فقط پرایمر معکوس به DNAی هدف متصل خواهد شد که به‌نوبت الگو برای پرایمر فوروارد نیز تولید خواهد شد. معمولاً ۴۰-۳۵ چرخه برای آمپلیفیکاسیون موردنیاز است. پلی‌مرازهای هات-استارت به‌عنوان آمپلیفیکاسیون‌های غیراختصاصی پیشنهاد شده است که برای DNAی تغییریافته توسط بی‌سولفیت که غنی از ATاست، معمول می‌بـــاشد. دمای ذوب در حدود ۶۰-۵۵ درجه خیلی خوب کار می‌کند و شیب دمای ذوب باید برای هر پرایمر جدید، به‌منزله اطمینان از آمپلی‌فیکاسیون اُپتیمُم از هدف خاص، ایجاد گردد.

qMSP-PCR

:MS-PCR

PCR خاص متیلاسیون (MS-PCR) متکی به آمپلی‌فیکاسیون برای ارزیابی وضعیت متیلاسیون در جایگاه‌های CPG خاص می‌باشد. موفقیت با این سیستم بستگی به آمپلی‌فیکاسیون افتراقی میان پرایمرهای طراحی‌شده برای نواحی متیله با نواحی غیرمتیله دارد. درحالی‌که بیشتر ملاحظات برای طراحی پرایمر در این روش نیز یکسان است، اما تریتمنت نواحی CPG در درون پرایمر کاملاً متفاوت می‌باشــــد. برای MSP، مستقر شدن جایگاه‌های CPG در انتهای `۳ پرایمرها با سیتوزین‌ها در پرایمرهای متیله و تیمین‌ها در پرایمرهای غیر‌متیله خیلی ضروری است.

qMSP-PCR

متیلاسیون سیتوزین در دی‌نوکلئوتید CPG شکل معمول خیلی از ژنوم‌های یوکاریوتی می‌باشد، در وضعی که هر دو رزیدوی سیتوزینی روی تشکیل رشته مقابل هم متیله می‌شوند. در مقایسه با دیگر دی‌نوکلئوتیدها، جزایر CPG در ژنوم مهره‌داران به‌جز کلاسترهای جزایر CPG درصد کمتری را به خود اختصاص داده‌اند. تعریف موردقبول جزایر CPG، به مناطقی از DNA که بیش از ۲۰۰ جفت باز می‌باشند، با محتوی سیتوزین/گوانین در حدود ۰/۵ درصد، اطلاق می‌شود. تقریباً ۶۰ درصد ژنوم انسانی در انتهای `۵ حاوی جزایر CPG می‌باشد. متیلاسیون سیتوزین به‌عنوان یک مکانیسم مهم در تنظیم اپی‌ژنتیک عملکرد ژنوم تشخیص داده شده است و نقش‌های مهمی در فرآیندهای زیستی مختلفی مانند امبریوژنزیس، غیرفعال‌سازی کروموزوم X و سرطان بازی می‌کند. نقشه الگوی متیلاسیون در جزایر CPG به‌عنوان یک ابزار مهم در فهم میزان بیان ژن‌های افراد نرمال و بیمار می‌باشد.

تکنیک‌های معروفی برای نقشه متیلاسیون سیتوزین ابداع شده است که در میان آنها، روش‌های تریت کردن با بی‌سولفیت در سال‌های اخیر بیشترین کاربرد را در تشخیص سریع جایگاه‌های سیتوزین متیله شده (۵mC) دارند. برای اولین بار در سال ۱۹۷۰ واکنش بی‌سولفیت مشخص گردید و توسط Formmer و همکارانش در سال ۱۹۹۲ به‌منظور تمیز دادن میان سیتوزین و mC5 در DNA مورد استفاده قرار گرفت. در این واکنش در ابتدا DNA توسط سدیم بی‌سولفیت تریت می‌شود که باعث تبدیل رزیدوهای سیتوزینی به یوراسیل در تک‌رشته DNA می‌گردد که تحت این شرایط جایگاه‌های mC5 بدون تغییر باقی می‌ماند. توالی DNA موردنظر به‌وسیله PCR توسط پرایمرهای خاص DNAی مدیفای شده با بی‌سولفیت آمپلی‌فای می‌شود.

پس از شرح واکنش بی‌سولفیت در کاربرد مطالعه mC5، بیشتر روش‌ها بر پایه‌ی اصول یکسانی شامل BSP (سکانس‌یابی بی‌سولفیتی PCR) یا MSP (PCR خاص متیلاسیون) و روش‌هایی بر پایه کمیت (‌‌‌COBRA) گسترش یافته است. تمام روش‌های فوق بر اساس طرز عمل یکسانی است که در آن DNA توسط بی‌سولفیت به‌وسیله پرایمرهای اختصاصی مدیفای می‌گردند.

به‌منظور اجرای موفق این روش‌ها، مهم‌ترین گام، طراحی کردن پرایمرها برای DNAی مدیفای‌شده می‌باشد. وجود برنامه‌هایی برای PCR استاندارد نمی‌توانند طراحی پرایمر را برای PCR خاص BSP راه‌اندازی کند. بدین منظور برای طراحی پرایمر برای BSP، نباید درون پرایمرها دارای جایگاه CPG باشد درحالی‌که برای جایگاه MSP، حتماً باید دارای یک جایگاه CPG باشد.

qMSP-PCR

قواعد MS-PCR و طراحی پرایمر خاص آن:

  1. پرایمرها باید حاوی حداقل یک جایگاه CPG در درون توالی خود باشند و جایگاه CPG باید ترجیحاً در انتهای `۳ توالی خود قرار گیرد تا بتواند بین نواحی متیله و غیرمتیله تمیز قائل شود.
  2. پرایمرها باید تعداد کافی از سیتوزین غیرمتیله در ناحیهCPG در توالی خود داشته باشد تا فقط در مرحله‌ی تریت شدن با بی‌سولفیت مدیفای گردد. پرایمرهایی که ناحیه سیتوزین غیرمتیله در CPG بیشتری دارند، ارجحیت دارند.
  3. پرایمرهای خاص نواحی DNA متیله (M) و غیرمتیله (U) باید حاوی جایگاه‌های CPGی در توالی خود باشد. برای مثال، پرایمر فوروارد در جفت M، حاوی این توالی‌ها هستند:

ATTAGTTTCGTTTAAGGTTCGA

  1. اما آنها ممکن است که در طول و جایگاه شروع با همدیگر تفاوت داشته باشند.
  2. این جفت پرایمرها (‌‌ M و U) باید یک دمای هیبریداسیون شبیه به همدیگر داشته باشند.

 

جزایر CPG و طراحی پرایمر:

  • اگر جزایر CPGی در طراحی پرایمر مورد استفاده قرار گرفته ‌شده و بیش از یک جزیره تشخیص داده شده است، هرکدام از جزایر اعلام‌شده می‌توانند به‌عنوان یک تارگت برای انتخاب پرایمر مورد استفاده قرار گیرند.
  • اگر اندازه جزایر CPG کوچک‌تر از حداقل اندازه محصول است، جفت پرایمر باید تمام جزایر را احاطه کند.
  • اگر اندازه جزایر CPG بزرگ‌تر از ماکزیمم اندازه محصول است، جفت پرایمر باید در درون جزایر قرار گیرد.
  • اگر اندازه جزایر CPG میان حداقل و حداکثر اندازه محصول قرار می‌گیرد، حداقل باید دوسوم منطقه جزایر آمپلی‌فای گردد.

 

برگرفته از مقاله Methods for optimizing methylation specific PCR:

یکی از معایب بزرگ روش PCR خاص متیلاسیون این است که فقط جایگاه کم CPG که در روی توالی DNAی الگو قرار دارند و می‌توانند با پرایمرها جفت شوند، مورد تحقیق قرار می‌گیرند که آیا این جایگاه‌ها متیله شده‌اند یا به‌صورت غیرمتیله هستند و درصورتی‌که این جزایر CPG در خارج از مناطق جفت‌شونده با پرایمر باشند، باید روش‌های دیگر خاص مطالعات متیلاسیون انجام گیرد.

همچنین در این مطالعات مشخص شده است که حساسیت آشکار PCR خاص متیلاسیون با توجه به روش‌های استفاده‌شده مختلف در تعیین دمای آنلینگ پرایمرها، بخصوص زمانی که به‌طور همزمان پرایمرهای متیله و غیرمتیله استفاده می‌شود، نتایج متفاوتی را بر جای می‌گذارد. در اینجا یک روش اُپتیماز شده مؤثر شرح داده شد که منجر به افزایش حساسیت در این وضعیت خواهد شد.

 

روش کار:

استخراج DNA از سلول‌های موردنظر

  • دناچوراسیون ۲ میکروگرم از DNA در ۱۸ میکرولیتر آب توسـط اضافه کردن ۲ میکرولیتر NaOH 3M به دنبال انکوباسیون در دمای ۳۷ درجه به مدت ۱۵ دقیقه
  • افزودن محلول ۲۸۰ میکرولیتر اوره M4/ بی‌سولفیت M 4 و ۲ میکرولیتر هیدروکوئینون mM100
  • سپس نمونه‌ها برای ۱۶ چرخه به مدت ۱۵ دقیقه و در ۵۵ درجه و ۳۰ ثانیه در دمای ۹۵ درجه انکوبه می‌شوند
  • سپس نمونه‌های مدیفای‌شده توسط سیستم خالص‌سازی، خالص‌سازی می‌شوند و هر ۲۵ میکرولیتر واکنش باید حاوی ۲ میکرولیتر DNAی الگو، ۰٫۲ میلی‌مول dNTPs، ۰٫۲ میکرومول از هر پرایمر، ۲ میلی‌مول MgCL2 و ۱ واحد پلیمراز Hot start tagman در بافر PCR باشد.

 

پروتکل مربوط به MSP-PCR کیت Zymo:

این کیت قادر است تمامی نقاطی که به‌صورت CPG-rich هستند را در کمتر از ۳ ساعت بی‌سولفیته کند.

مرحله مربوط به واکنش دناتوراسیون/ تبدیل همراه با گرما و تبدیل سیتوزین‌های غیرمتیله به یوراسیل بسیار مؤثر و کارآمد عمل می‌کند.

رسوب DNA حذف شده است. در عوض، DNA دریک مرحله با استــــفاده از ستون‌های اسپین  هم دسولفیته و هم پاکسازی می‌شود.

DNA فوق‌العاده خالص و رقیق‌شده برای استفاده آنالیزهای مولکولی، ایده‌آل است.

 

نکات آماده‌سازی:

به ازای هر واکنش CT conversion ،۹۰۰ میکرولیتر آب، ۳۰۰ میکرولیتر M-Dilution buffer و ۵۰ میکرولیتر M-Dissolving buffer قبل از استفاده اضافه کنید.

به مقدار ۹۶ میکرولیتر از اتانول ۱۰۰% روی ۲۴ میکرولیتر بافرM-Wash  اضافه می‌کنیم.

این کیت (EZ DNA Methylation-GoldTM Kit ) قادر است که فرآیندهای مربوط به دناتوراسیون و تبدیل DNA را دریک مرحله انجام دهد. این عمل با استفاده از جایگزینی دناتوراسیون گرمایی در دناتوراسیون شیمیایی با استفاده از سدیم هیدروکسید در پروتکل قبلی انجام می‌شود. همچنین این کیت برای افزایش بازده بازیابی DNA به دنبال تبدیل DNA بی‌سولفیته بسیار مؤثر می‌باشد. این کیت بر پایه فرایند سه واکنش میان سیتوزین و سدیم بی‌سولفیت منجر به تبدیل سیتوزین به یوراسیل می‌شود. این کیت با استفاده از تکنولوژی دسولفوناسیون داخل ستون‌ها که مراحل طاقت‌فرسای رسوب‌گذاری DNA تا زمان بدست آوردن نتایج مطلوب برای محققین انجام می‌شد را حذف کرده است. این کیت برای به حداقل رساندن تخریب و از دست دادن DNA در زمان تریت کردن و پاکسازی و همچنین تبدیل کامل سیتوزین غیر متیله، طراحی شده است.

DNAی تبدیل‌شده برای آنالیزهای مولکولی مانند اثرگذاری آنزیم آندونوکلئاز، سکانس یا میکرواَرِی بسیار مفید می‌باشد.

 

خصوصیات کیت:

DNAی ورودی: نمونه‌ها باید حاوی ۵۰۰ پیکوگرم تا ۲ میکروگرم DNA باشند. بهترین حالت، میزان DNAی ورودی ۵۰۰-۲۰۰ نانوگرم می‌باشد.

بازده تبدیل: بیش از ۹۹% سیتوزین‌های غیر‌متیله به یوراسیل تبدیل می‌شوند و بیش از ۹۹% محافظت از سیتوزین‌های متیله را انجام می‌دهد.

میزان DNA Recovery: بیش از ۷۵%

 

تهیه‌ی واکنش‌گرها:

آماده کردن واکنش تبدیل CT:

این ماده در داخل کیت به‌صورت ماده جامد می‌باشد که بایستی قبل از استفاده به‌صورت محلول تهیه شود. برای همین طبق پروتکل زیر عمل می‌کنیم:

  1. افزودن ۹۰۰ میکرولیتر آب، ۳۰۰ میکرولیتر M-Dilution Buffer و ۵۰ میکرولیتر

M-Dissolving Buffer در تیوب‌های مخصوص واکنشگر تبدیل CT

  1. به مدت ۱۰ دقیقه در دمای اتاق توسط ورتکس یا شیک مخلوط می‌کنیم.

توجه ۱: معمول است که مقدار کمی از ماده به‌صورت غیرمحلول در تیوب دیده شود. هرکدام از تیوب‌های واکنشگر برای تریت کردن ۱۰ نمونه در نظر گرفته شده است.

توجه ۲: ذخیره‌سازی: این محلول نسبت به روشنایی حساس است و بنابراین باید تا حد امکان به دور از روشنایی باشد.

برای گرفتن نتایج مطلوب، بهترین حالت این است که به‌محض آماده‌سازی محلول، فوراً استفاده شود. همچنین این محلول را می‌توان به‌صورت شبانه در دمای اتاق به‌منظور استفاده فوری نیز نگهداری کرد، اما در صورت نگهداری به مدت یک هفته بهتر است در دمای اتاق و به مدت یک ماه در دمای ۲۰- درجه نگهداری شود. قبل از استفاده از این محلول در دمای ۳۷ باید گرم و سپس ورتکس گردد.

 

آماده‌سازی M-Wash Buffer:

به مقدار ۹۶ میلی‌لیتر از اتانول ۱۰۰% را روی تیوب مربوط به M-Wash Buffer می‌ریزیم.

 

پروتکل:

  1. اضافه کردن ۱۳۰ میکرولیتر از واکنش‌گر CT روی ۲۰ میکرولیتر از نمونه DNA در تیوب PCR. اگر حجم نمونه DNA کمتر از ۲۰ میکرولیتر می‌باشد، مابقی آن را توسط آب کامل کنید. نمونه‌ها را توسط فلیکینگ تیوب یا پیپتینگ و آپ و داون کردن مخلوط کنید. سانتریفیوژ (۱۳۰ میکرولیتر از CT+)
  2. نمونه‌های آماده‌شده را در داخل ترموسایکلر قرار داده و طبق پروتکل زیر انجام دهید.

۹۸˚C for 10 minutes

۶۴˚C for 2.5 hours

۴˚C storage up to 20 hours

برای برخی از نمونه‌ها روش‌های جایگزین پیشنهاد شده است.

  1. به مقدار ۶۰۰ میکرولیتر M-Binding buffer در داخل ستون‌های Zymo-spin IC ریخته و ستون را درون یک تیوب جمع‌آوری قرار دهید
  2. نمونه‌ها را (آماده‌شده در مرحله ۲) درون ستون Zymo-Spin IC حاوی M-Binding buffer لود کنید درب ستون را بسته و توسط وارونه کردن ستون چندین بار نمونه را مخلوط کنید.
  3. با تمام سرعت بیش از g 10000 به مدت ۳۰ ثانیه سانتریفیوژ می‌کنیم. مایع ریخته شده به تیوب پایینی را دور می‌ریزیم
  4. به مقدار ۱۰۰ میکرولیتر از بافر M-Wash را درون ستون می‌ریزیمT سپس با تمام سرعت به مدت ۳۰ ثانیه سانتریفیوژ می‌کنیم
  5. ۲۰۰ میکرولیتر از بافر M-Desulphonation را درون ستون افزوده و سپس اجازه دهید به مدت ۱۵-۱۰ دقیقه در دمای اتاق (۲۰ الی ۳۰) قرار گیرد. پس از انکوباسیون به مدت ۳۰ ثانیه با تمام سرعت سانتریفیوژ کنید.
  6. افزودن ۲۰۰ میکرولیتر بافر M-Wash در ستون سانتریفیوژ با تمام سرعت به مدت ۳۰ ثانیه افزودن ۲۰۰ میکرولیتر دیگر از بافر M-Wash و سانتریفیوژ کردن به مدت ۳۰ ثانیه
  7. ستون را درون تیوب میکروسانتریفیوژ قرار دهید. ۱۰ میکرولیتر بافر M-Elution را به‌طور مستقیم در زمینه ستون بریزید و با تمام سرعت به مدت ۳۰ ثانیه سانتریفیوژ کنید.

 

 

References:

  1. Liloglou, T., Bediaga, N. G., Brown, B. R., Field, J. K. and Davies, M. P. (2012). Epigenetic biomarkers in lung cancer. Cancer Lett 342(2): 200-212.
  2. Nikolaidis, G., Raji, O. Y., Markopoulou, S., Gosney, J. R., Bryan, J., Warburton, C., Walshaw, M., Sheard, J., Field, J. K. and Liloglou, T. (2012). DNA methylation biomarkers offer improved diagnostic efficiency in lung cancer. Cancer Res 72(22): 5692-5701.
  3. Liloglou, T. and Nikolaidis, G. (2013). Quantitative Methylation Specific PCR (qMSP). Bio-protocol 3(16): e871. DOI: 10.21769/BioProtoc.871.
  4. Rijkaart DC, Berkhof J, Rozendaal L, van Kemenade FJ, Bulkmans NW, Heideman DA, Kenter GG, Cuzick J, Snijders PJ, Meijer CJ: Human papillomavirus testing for the detection of high-grade cervical intraepithelial neoplasia and cancer: final results of the POBASCAM randomised controlled trial. Lancet Oncol. 2012, 13 (1): 78-88.
  5. Eijsink JJ, Yang N, Lendvai A, Klip HG, Volders HH, Buikema HJ, van Hemel BM, Voll M, Coelingh Bennink HJ, Schuuring E, et al: Detection of cervical neoplasia by DNA methylation analysis in cervico-vaginal lavages, a feasibility study. Gynecol Oncol. 2011, 120 (2): 280-283. 10.1016/j.ygyno.2010.10.029.
  6. Overmeer RM, Louwers JA, Meijer CJ, van Kemenade FJ, Hesselink AT, Daalmeijer NF, Wilting SM, Heideman DA, Verheijen RH, Zaal A, et al: Combined CADM1 and MAL promoter methylation analysis to detect (pre-)malignant cervical lesions in high-risk HPV-positive women. Int J Cancer. 2010, 129 (9): 2218-2225.
  7. Hesselink AT, Heideman DA, Steenbergen RD, Coupe VM, Overmeer RM, Rijkaart D, Berkhof J, Meijer CJ, Snijders PJ: Combined promoter methylation analysis of CADM1 and MAL: an objective triage tool for high-risk human papillomavirus DNA-positive women. Clin Cancer Res. 2011, 17 (8): 2459-2465. 10.1158/1078-0432.CCR-10-2548.
  8. Eijsink JJ, Lendvai A, Deregowski V, Klip HG, Verpooten G, Dehaspe L, de Bock GH, Hollema H, van Criekinge W, Schuuring E, et al: A four-gene methylation marker panel as triage test in high-risk human papillomavirus positive patients. Int J Cancer. 2012, 130 (8): 1861-1869. 10.1002/ijc.26326.
  9. Morandi L, Franceschi E, de Biase D, Marucci G, Tosoni A, Ermani M, Pession A, Tallini G, Brandes A: Promoter methylation analysis of O6-methylguanine-DNA methyltransferase in glioblastoma: detection by locked nucleic acid based quantitative PCR using an imprinted gene (SNURF) as a reference. BMC Cancer. 2010, 10: 48-10.1186/1471-2407-10-48.

اپی‌ژنتیک و سرطان

استخراج و خالص‌سازی DNA پلاسمیدی از سودوموناس آئروجینوزا

تکنیک‌های تعیین توالی اسید نوکلئیک

روش‌های عملی در Time PCR – Real قسمت۵

انواع مختلف PCR

برای دانلود پی دی اف بر روی لینک زیر کلیک کنید

برچسبها
  • DNA
  • qMSP-PCR
  • سودا ذبیحی خداپسند
  • متیلاسیون
  • مهسا جمالی

دیدگاهتان را بنویسید

نشانی ایمیل شما منتشر نخواهد شد. بخش‌های موردنیاز علامت‌گذاری شده‌اند *